MISSION® esiRNA

Name	MISSION® esiRNA
Supplier	Sigma-Aldrich
Catalog	EHU070511
Category	siRNA
Prices	$140.00, $250.00
Sizes	20 µg, 50 µg
Applications	Gene Silencing
Gene	CDK4
Sequence	GAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGAGATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTGGTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCACACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCCGGAGTGAGCAATGGAGTGGCTGCCATGGAAGGAAGAAAAGCTGCCATTTCCCTTCTGGACACTGAGAGGGCAATCTTTGCCTTTATCTCTGAGGCTATGGAGGGTCCTCCTCCATCTTTCTACAGAGATTACTTTGCTGCCTTAATGACATTCCCCTCCCACCTCTCCTTTTGAGGCTTCTCCTTCTCCTTCCCA
Description	MISSION esiRNA are endo-ribonuclease prepared siRNA
Supplier Page	Shop

Product images

<B>Immunoblotting</B><BR/>CDK4: <B>Cat. No. EHU070511</B>: Western blot analysis of CDK4 in HeLa cells.<BR/><B>Lanes</B><BR/>1. HeLa cells transfected with Renilla Luciferase esiRNA (RLUC, <B>Cat. No. EHURLUC</B>) as negative control.<BR/>2. HeLa cells transfected with CDK4 esiRNA (<B>Cat. No. EHU070511</B>). Quantitative-Immunoblotting: Lysates were separated on SDS-Page and probed with mouse Monoclonal Anti-Cdk4 (1:1000) Clone: DCS-31 (<B>Cat. No. C8218</B>) and goat Anti-GAPDH (1:7000) (Acris) antibodies. The signal intensities of indicated bands were quantified using an Odyssey infrared imaging system (Li-COR) and normalized to the GAPDH signal. At 72h post transfection, a 70% CDK4 protein reduction was measured between the negative control RLUC and the sample treated with CDK4 esiRNA.

Immunoblotting
CDK4: Cat. No. EHU070511: Western blot analysis of CDK4 in HeLa cells.
Lanes
1. HeLa cells transfected with Renilla Luciferase esiRNA (RLUC, Cat. No. EHURLUC) as negative control.
2. HeLa cells transfected with CDK4 esiRNA (Cat. No. EHU070511). Quantitative-Immunoblotting: Lysates were separated on SDS-Page and probed with mouse Monoclonal Anti-Cdk4 (1:1000) Clone: DCS-31 (Cat. No. C8218) and goat Anti-GAPDH (1:7000) (Acris) antibodies. The signal intensities of indicated bands were quantified using an Odyssey infrared imaging system (Li-COR) and normalized to the GAPDH signal. At 72h post transfection, a 70% CDK4 protein reduction was measured between the negative control RLUC and the sample treated with CDK4 esiRNA.