MISSION® esiRNA

Name	MISSION® esiRNA
Supplier	Sigma-Aldrich
Catalog	EHU083501
Category	siRNA
Prices	$140.00, $250.00
Sizes	20 µg, 50 µg
Applications	Gene Silencing
Gene	AKT1
Sequence	ACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTGGCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCTGTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTATGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCATCGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCC
Description	MISSION esiRNA are endo-ribonuclease prepared siRNA
Supplier Page	Shop

Product images

<B>Immunoblotting</B><BR/>AKT1: <B>Cat. No. EHU083501</B>: Western blot analysis of AKT1 in HeLa cells.<BR/><B>Lanes</B><BR/>1. HeLa cells transfected with Renilla Luciferase esiRNA (RLUC, <B>Cat. No. EHURLUC</B>) as negative control.<BR/>2. HeLa cells transfected with AKT1 esiRNA (<B>Cat. No. EHU083501</B>). Quantitative-Immunoblotting: Lysates were separated on SDS-Page and probed with mouse Monoclonal Anti-Protein Kinase Bα (1:5000) Clone: PKB-175 (<B>Cat. No. P2482</B>) and goat Anti-GAPDH (1:7000) (Acris) antibodies. The signal intensities of indicated bands were quantified using an Odyssey infrared imaging system (Li-COR) and normalized to the GAPDH signal. At 72h post transfection, an 88% AKT1 protein reduction was measured between the negative control RLUC and the sample treated with AKT1 esiRNA.

Immunoblotting
AKT1: Cat. No. EHU083501: Western blot analysis of AKT1 in HeLa cells.
Lanes
1. HeLa cells transfected with Renilla Luciferase esiRNA (RLUC, Cat. No. EHURLUC) as negative control.
2. HeLa cells transfected with AKT1 esiRNA (Cat. No. EHU083501). Quantitative-Immunoblotting: Lysates were separated on SDS-Page and probed with mouse Monoclonal Anti-Protein Kinase Bα (1:5000) Clone: PKB-175 (Cat. No. P2482) and goat Anti-GAPDH (1:7000) (Acris) antibodies. The signal intensities of indicated bands were quantified using an Odyssey infrared imaging system (Li-COR) and normalized to the GAPDH signal. At 72h post transfection, an 88% AKT1 protein reduction was measured between the negative control RLUC and the sample treated with AKT1 esiRNA.